ID: 954249812_954249821

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 954249812 954249821
Species Human (GRCh38) Human (GRCh38)
Location 3:49358722-49358744 3:49358767-49358789
Sequence CCGGCAGTGCAGGGGACAGCCAG CCTCCTCCCTGTCTCCAAAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 44, 4: 374} {0: 1, 1: 0, 2: 5, 3: 31, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!