ID: 954287599_954287613

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 954287599 954287613
Species Human (GRCh38) Human (GRCh38)
Location 3:49629936-49629958 3:49629979-49630001
Sequence CCAACTCCTACCCAATGGCAAAC CAGGGTGGGCGGCGTGGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 138} {0: 1, 1: 0, 2: 4, 3: 68, 4: 652}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!