ID: 954288469_954288480

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 954288469 954288480
Species Human (GRCh38) Human (GRCh38)
Location 3:49636350-49636372 3:49636389-49636411
Sequence CCAGCCTCTCCTGGAGAGGGTTA GTGTGTATGGGGAGGGTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 164} {0: 1, 1: 0, 2: 9, 3: 77, 4: 650}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!