ID: 954294139_954294148

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 954294139 954294148
Species Human (GRCh38) Human (GRCh38)
Location 3:49664874-49664896 3:49664893-49664915
Sequence CCTTGCCTCTTCTGGGAAAGGCC GGCCCGAGGCACTGGGGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 229} {0: 1, 1: 0, 2: 2, 3: 35, 4: 525}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!