ID: 954302282_954302297

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 954302282 954302297
Species Human (GRCh38) Human (GRCh38)
Location 3:49706372-49706394 3:49706419-49706441
Sequence CCACTGCACCCTCCGGAGCCCTC AGGTGGGGCCCAGTGTGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 46, 4: 386} {0: 1, 1: 0, 2: 5, 3: 35, 4: 419}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!