ID: 954314709_954314722

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 954314709 954314722
Species Human (GRCh38) Human (GRCh38)
Location 3:49794890-49794912 3:49794915-49794937
Sequence CCACCCCTTCCCACTGCAAGCAC TGCAAGTGGGTCTGGGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 542} {0: 1, 1: 0, 2: 0, 3: 25, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!