ID: 954314709_954314724

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 954314709 954314724
Species Human (GRCh38) Human (GRCh38)
Location 3:49794890-49794912 3:49794920-49794942
Sequence CCACCCCTTCCCACTGCAAGCAC GTGGGTCTGGGAGCTGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 542} {0: 1, 1: 0, 2: 9, 3: 107, 4: 1163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!