ID: 954322114_954322117

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 954322114 954322117
Species Human (GRCh38) Human (GRCh38)
Location 3:49839379-49839401 3:49839401-49839423
Sequence CCTCGTGGCTCCCTCTGCTGGCA AGCTTTAAAGCACGCACTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 251} {0: 1, 1: 0, 2: 1, 3: 3, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!