ID: 954325296_954325300

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 954325296 954325300
Species Human (GRCh38) Human (GRCh38)
Location 3:49860170-49860192 3:49860185-49860207
Sequence CCTTCCACTTGGCCCTGGCAAAG TGGCAAAGTTCTTTTCAATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 820} {0: 1, 1: 0, 2: 1, 3: 10, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!