ID: 954328585_954328603

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 954328585 954328603
Species Human (GRCh38) Human (GRCh38)
Location 3:49877211-49877233 3:49877257-49877279
Sequence CCTCTGAGGCCACTCCCCAGCTG CCTGGGGACCCGATGGATCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 374} {0: 1, 1: 0, 2: 0, 3: 8, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!