ID: 954331953_954331962

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 954331953 954331962
Species Human (GRCh38) Human (GRCh38)
Location 3:49895924-49895946 3:49895949-49895971
Sequence CCCGTGTTTCCCAGGGAGGTCCA TGGGCTGCCTACCTGCAATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 358} {0: 1, 1: 0, 2: 0, 3: 13, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!