ID: 954366816_954366828

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 954366816 954366828
Species Human (GRCh38) Human (GRCh38)
Location 3:50150895-50150917 3:50150926-50150948
Sequence CCAGCTTTTGATCGGCTCAGAGC GGGGCAGGCTGGGCAGGAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 22, 3: 230, 4: 1569}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!