ID: 954375977_954375987

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 954375977 954375987
Species Human (GRCh38) Human (GRCh38)
Location 3:50194326-50194348 3:50194355-50194377
Sequence CCTGTCCCGGGCGGCCTGAGGAG AGGCGTTCAGCAGGCCCATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 161} {0: 1, 1: 0, 2: 1, 3: 7, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!