ID: 954377989_954377997

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 954377989 954377997
Species Human (GRCh38) Human (GRCh38)
Location 3:50205056-50205078 3:50205086-50205108
Sequence CCCCCACAAGACTCAACGGAGTC CAGCTCTGCTCTCCCACCTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67} {0: 1, 1: 0, 2: 1, 3: 29, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!