ID: 954378299_954378305

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 954378299 954378305
Species Human (GRCh38) Human (GRCh38)
Location 3:50206118-50206140 3:50206154-50206176
Sequence CCGGTTGGCCCCTTCGATTGGCC GCGTTTGTTTACACCCAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 45} {0: 1, 1: 0, 2: 1, 3: 11, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!