ID: 954379696_954379704

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 954379696 954379704
Species Human (GRCh38) Human (GRCh38)
Location 3:50213028-50213050 3:50213055-50213077
Sequence CCCAGCCACCTCTGGTTATGAGG CAATTCCTGGACCCAGTGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 143} {0: 1, 1: 0, 2: 1, 3: 13, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!