ID: 954385919_954385930

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 954385919 954385930
Species Human (GRCh38) Human (GRCh38)
Location 3:50243795-50243817 3:50243843-50243865
Sequence CCATGGCCCTTTGGGAGTCTGTG GGACAGCAGGCAGACGGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 609} {0: 1, 1: 0, 2: 2, 3: 17, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!