ID: 954385922_954385930

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 954385922 954385930
Species Human (GRCh38) Human (GRCh38)
Location 3:50243802-50243824 3:50243843-50243865
Sequence CCTTTGGGAGTCTGTGCTGGCTG GGACAGCAGGCAGACGGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 409} {0: 1, 1: 0, 2: 2, 3: 17, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!