ID: 954389581_954389598

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 954389581 954389598
Species Human (GRCh38) Human (GRCh38)
Location 3:50261584-50261606 3:50261633-50261655
Sequence CCACCCCCTGTCCCAGCAGGTAG AGGGGGAAAGGGCCCTCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 298} {0: 1, 1: 0, 2: 2, 3: 17, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!