ID: 954407167_954407169

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 954407167 954407169
Species Human (GRCh38) Human (GRCh38)
Location 3:50351645-50351667 3:50351665-50351687
Sequence CCTGGCTGGTTGAGGGAATTCTG CTGTGCTGGAGCGATGAGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 174} {0: 1, 1: 0, 2: 0, 3: 24, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!