ID: 954407556_954407569

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 954407556 954407569
Species Human (GRCh38) Human (GRCh38)
Location 3:50353910-50353932 3:50353956-50353978
Sequence CCCATTTCCTTCCCCTTTCTCTG CATGTGTCTGGATGAAGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 14, 3: 124, 4: 1122} {0: 1, 1: 0, 2: 2, 3: 13, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!