ID: 954421554_954421564

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 954421554 954421564
Species Human (GRCh38) Human (GRCh38)
Location 3:50421601-50421623 3:50421623-50421645
Sequence CCCTGCTCCCCAACTCTTCAGCC CCTTGGTACTACAGGGACACAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 6, 3: 60, 4: 734} {0: 1, 1: 0, 2: 0, 3: 5, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!