ID: 954421555_954421564

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 954421555 954421564
Species Human (GRCh38) Human (GRCh38)
Location 3:50421602-50421624 3:50421623-50421645
Sequence CCTGCTCCCCAACTCTTCAGCCC CCTTGGTACTACAGGGACACAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 49, 4: 513} {0: 1, 1: 0, 2: 0, 3: 5, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!