ID: 954427723_954427735

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 954427723 954427735
Species Human (GRCh38) Human (GRCh38)
Location 3:50452167-50452189 3:50452208-50452230
Sequence CCTCAATGGGGACAGCTCTGATG GCTGTCTGTGGAATTGGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 155} {0: 1, 1: 0, 2: 2, 3: 17, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!