ID: 954428699_954428711

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 954428699 954428711
Species Human (GRCh38) Human (GRCh38)
Location 3:50457811-50457833 3:50457857-50457879
Sequence CCACCCTCCTACTCCCTCAGCTT GTGATGATGGGGACTGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 81, 4: 867} {0: 1, 1: 0, 2: 1, 3: 48, 4: 545}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!