ID: 954440112_954440123

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 954440112 954440123
Species Human (GRCh38) Human (GRCh38)
Location 3:50517085-50517107 3:50517131-50517153
Sequence CCCCCATGGTGCTGGGTCCCCCA TGATGTTTGAACAACTTTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 205} {0: 1, 1: 0, 2: 0, 3: 26, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!