ID: 954468928_954468938

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 954468928 954468938
Species Human (GRCh38) Human (GRCh38)
Location 3:50675167-50675189 3:50675207-50675229
Sequence CCGCCTCGACTCGCGGTGCGCCA GTCCCCGCCGCGTTGTCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 16} {0: 1, 1: 0, 2: 0, 3: 6, 4: 29}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!