ID: 954470070_954470074

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 954470070 954470074
Species Human (GRCh38) Human (GRCh38)
Location 3:50686223-50686245 3:50686266-50686288
Sequence CCAGTCAATGCCTTAATCTCGCT AAACTCTGCTGCACAAAAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 67} {0: 1, 1: 0, 2: 6, 3: 46, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!