ID: 954471402_954471404

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 954471402 954471404
Species Human (GRCh38) Human (GRCh38)
Location 3:50699070-50699092 3:50699087-50699109
Sequence CCATTTCGAGTTAATTTTTCTAT TTCTATGTGATAGTAGAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 37, 2: 911, 3: 6610, 4: 21554} {0: 1, 1: 0, 2: 1, 3: 33, 4: 1034}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!