ID: 954488116_954488121

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 954488116 954488121
Species Human (GRCh38) Human (GRCh38)
Location 3:50873525-50873547 3:50873572-50873594
Sequence CCAGCACTTTCTTAGCTACCCTA TTCCCTAATCCACTGGCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 46, 4: 200} {0: 1, 1: 0, 2: 2, 3: 10, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!