ID: 954493700_954493706

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 954493700 954493706
Species Human (GRCh38) Human (GRCh38)
Location 3:50931985-50932007 3:50932016-50932038
Sequence CCCACAAAGGTACTCTTGTCCAT GTCAAAATTGATGCTTCTTGGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 12, 3: 40, 4: 170} {0: 1, 1: 0, 2: 5, 3: 22, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!