|
Left Crispr |
Right Crispr |
| Crispr ID |
954497221 |
954497223 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:50976294-50976316
|
3:50976311-50976333
|
| Sequence |
CCCACTACACACTGCTTTCAATG |
TCAATGTGTCCCAGAGATTCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 62, 2: 6847, 3: 2523, 4: 1043} |
{0: 31, 1: 5407, 2: 3554, 3: 2709, 4: 1770} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|