ID: 954510747_954510758

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 954510747 954510758
Species Human (GRCh38) Human (GRCh38)
Location 3:51122763-51122785 3:51122811-51122833
Sequence CCAGCTTCCCACTGCCCAGAAGA GCAGGATTTATGGATATATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 354} {0: 1, 1: 0, 2: 1, 3: 11, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!