ID: 954530122_954530126

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 954530122 954530126
Species Human (GRCh38) Human (GRCh38)
Location 3:51311173-51311195 3:51311222-51311244
Sequence CCAGCTTGTCCTGCAAGAGCAGC AAATTTTTCACCCCCTCTAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 191} {0: 1, 1: 0, 2: 1, 3: 10, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!