ID: 954535121_954535132

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 954535121 954535132
Species Human (GRCh38) Human (GRCh38)
Location 3:51354227-51354249 3:51354272-51354294
Sequence CCCCATTTAAAATTATTTGGTGG GTAACATTGGAGTCAGGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 287} {0: 1, 1: 0, 2: 1, 3: 11, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!