ID: 954540315_954540320

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 954540315 954540320
Species Human (GRCh38) Human (GRCh38)
Location 3:51389394-51389416 3:51389409-51389431
Sequence CCTACCAGTTTCTGCTTTCCAGT TTTCCAGTTGCAGAGTTTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 292} {0: 1, 1: 0, 2: 2, 3: 26, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!