ID: 954574371_954574379

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 954574371 954574379
Species Human (GRCh38) Human (GRCh38)
Location 3:51667464-51667486 3:51667514-51667536
Sequence CCCACTTCCTTTTGATTTCTCAG CTTCTGTGCACCCAGCTCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 93, 4: 518} {0: 1, 1: 2, 2: 1, 3: 35, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!