ID: 954580862_954580867

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 954580862 954580867
Species Human (GRCh38) Human (GRCh38)
Location 3:51702334-51702356 3:51702348-51702370
Sequence CCTGGGAGCCACACCTGGGGCCT CTGGGGCCTCAGCAAGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 349} {0: 1, 1: 0, 2: 5, 3: 40, 4: 396}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!