ID: 954581957_954581961

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 954581957 954581961
Species Human (GRCh38) Human (GRCh38)
Location 3:51707696-51707718 3:51707709-51707731
Sequence CCTGCCCTGGGGAGCTGAGGGGG GCTGAGGGGGCAAAATGAAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 48, 4: 689} {0: 1, 1: 0, 2: 0, 3: 26, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!