ID: 954610279_954610290

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 954610279 954610290
Species Human (GRCh38) Human (GRCh38)
Location 3:51941547-51941569 3:51941568-51941590
Sequence CCAAGGGCCCCCCCCCCTCGGTT TTCCCTCAGAACCCCAGGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 151} {0: 1, 1: 0, 2: 0, 3: 21, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!