ID: 954637626_954637636

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 954637626 954637636
Species Human (GRCh38) Human (GRCh38)
Location 3:52079801-52079823 3:52079854-52079876
Sequence CCAGAACTCCCTCTTGCTGGGGT CTGCTGACCTTGGAGAAACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 132} {0: 1, 1: 0, 2: 3, 3: 16, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!