ID: 954641032_954641041

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 954641032 954641041
Species Human (GRCh38) Human (GRCh38)
Location 3:52097977-52097999 3:52098020-52098042
Sequence CCTACCACAGTGGCCCCCAGACT CACAGCAGAGTGCAGTGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 300} {0: 1, 1: 0, 2: 3, 3: 52, 4: 595}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!