ID: 954643845_954643853

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 954643845 954643853
Species Human (GRCh38) Human (GRCh38)
Location 3:52118634-52118656 3:52118660-52118682
Sequence CCATGCAGGGTCTGCCCCTCTGG TCGACTGCTACGCTGGAATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 297} {0: 1, 1: 0, 2: 0, 3: 3, 4: 36}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!