ID: 954680730_954680737

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 954680730 954680737
Species Human (GRCh38) Human (GRCh38)
Location 3:52344609-52344631 3:52344631-52344653
Sequence CCCTCCCCAAGAAGGAGGAGGAG GCAGGTGCCTGAGCGAGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 497} {0: 1, 1: 0, 2: 5, 3: 26, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!