ID: 954682553_954682558

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 954682553 954682558
Species Human (GRCh38) Human (GRCh38)
Location 3:52353564-52353586 3:52353585-52353607
Sequence CCTGCAGGACCATATCGAGAGCA CATCAGCAAGGTGGCTGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 47} {0: 1, 1: 0, 2: 2, 3: 37, 4: 401}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!