ID: 954704276_954704281

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 954704276 954704281
Species Human (GRCh38) Human (GRCh38)
Location 3:52470804-52470826 3:52470847-52470869
Sequence CCCAGGGACTGGGGTCAGGTGGA TGTTCTCTGCAGGAGATAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 299} {0: 1, 1: 0, 2: 2, 3: 21, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!