ID: 954714465_954714473

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 954714465 954714473
Species Human (GRCh38) Human (GRCh38)
Location 3:52520256-52520278 3:52520278-52520300
Sequence CCCCCATCTCTTTCTCCTGCAGC CCGAACGCGGGCCGTGAGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 123, 4: 918} {0: 1, 1: 0, 2: 0, 3: 0, 4: 21}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!