ID: 954714796_954714803

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 954714796 954714803
Species Human (GRCh38) Human (GRCh38)
Location 3:52521633-52521655 3:52521678-52521700
Sequence CCTTGGGGGCTCTGGCTCCTGCT GCCACGCTGTGAGGTGCAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 58, 4: 481} {0: 1, 1: 0, 2: 3, 3: 4, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!