|
Left Crispr |
Right Crispr |
| Crispr ID |
954725104 |
954725107 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:52601675-52601697
|
3:52601693-52601715
|
| Sequence |
CCAGAGTGGTGTATACTGGCACT |
GCACTGGTGTTAGCAGGTCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 4, 3: 30, 4: 230} |
{0: 7, 1: 11, 2: 20, 3: 56, 4: 206} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|