ID: 954733037_954733040

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 954733037 954733040
Species Human (GRCh38) Human (GRCh38)
Location 3:52681536-52681558 3:52681570-52681592
Sequence CCAATCCCTTTTAAACAATCTAT AAGTGAATTTGATGAACATAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 25, 4: 305} {0: 1, 1: 0, 2: 1, 3: 27, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!